diff --git a/data/scenarios/tutorial/tutorial2.cfg b/data/scenarios/tutorial/tutorial2.cfg new file mode 100644 index 00000000000..aec135551f8 --- /dev/null +++ b/data/scenarios/tutorial/tutorial2.cfg @@ -0,0 +1,228 @@ +{./utils.cfg} +[tutorial] +name=Traits and Specialties +id=tutorial-2 +map_data="ggggggggggggggggccggggtff +gggtggggggggtggccggggggff +gggggggggggggcccgCCCggggf +gggggggfgtgccccggC1Cggggg +gggggfgffccgcggggrCgggggg +gggggffffcgggggrrggfggggg +ggggggffgcgggggrtggffgggg +gggtgggccgggggrggffffftgg +ggggggcgggggtrrgffffffffg +ggggggcggggggrggfffffffgg +ggggggcgggggrggfffftggggg +ffffgccgggggrgggggggggggg +fcfccggggggrrgggggggggggg +cgcggggggggrggggggggggggg +gggfffggtggrgggfgtggggggg +ggffffffgrrggggffffgggggg +gggtfgffgrgffffffgggghthg +gggggggrrggffffffggghhhhh +gggggggrggfffffffgggghhmh +ggtgggtrgffffffgggghhhhmm +gggCCCggggfgfgggggghmmmmm +ggfC2Cgtggggggggghhhhmmmm +tgffCfggggggggghthhmmmmmm +gtggfggggggtgghhhhhmmmmmm" +turns=24 +music=wesnoth-4.ogg + {DAWN} + {MORNING} + {AFTERNOON} + {DUSK} + {FIRST_WATCH} + {SECOND_WATCH} + [side] + type=Lord + side=1 + recruit=Elvish Archer,Elvish Fighter,Elvish Shaman,Elvish Scout + controller=human + [/side] + [side] + type=Elder Mage + description=Delfador + canrecruit=1 + side=2 + recruit=Elvish Archer,Elvish Fighter,Elvish Shaman,Elvish Scout + gold=11 + [ai] + passive_leader=yes + [/ai] + [/side] + [event] + name=start + [message] + description=Delfador + message= _ "Now you will be subject to a more difficult test. You must defeat me in mock battle." + [/message] + [message] + description=Delfador + message= _ "You can win most scenarios simply by defeating all enemy leaders. Win this scenario by defeating me. Your fighter from the previous scenario can help you in this battle. To recall him, right-click on a castle tile, select Recall, select your fighter, then select 'Ok'. You should also recruit Elvish Fighters and Elvish Archers." + [/message] + [/event] +objectives= _ "@Skills covered: +Recalling +Traits +Gold +Time of day +Terrains +Objects +Playing Wesnoth +@Objectives +@Victory +Defeat Delfador" + [event] + name=turn 2 + [message] + description=Delfador + message= _ "You may notice that your units have slightly different statistics than the statistics shown before you recruited them. This is because they have been assigned two traits." + [/message] + {QUESTION_OPTIONS_START ("En garde!")} +#define TRAIT_QUESTIONS +{QUESTION_OPTION ("What traits can my units get?") ("There are five traits. Any unit has an equal chance to get any two different traits when it is recruited. These are the five traits: +@Loyal: The unit never has a upkeep cost above 1. +@Strong: The unit does extra damage in close combat, and has a few more hitpoints. +@Quick: The unit has one extra movement point, but a few less hitpoints. +@Resilient: The unit has more hitpoints. +@Intelligent: The unit requires less experience to advance a level.")} +#enddef + {TRAIT_QUESTIONS} + {QUESTION_OPTIONS_END} + [/event] + [event] + name=turn 3 + [message] + description=Delfador + message= _ "When you recruit and recall units, you lose gold. If this would cause you to have less than 0 gold, you cannot recruit or recall." + [/message] + {QUESTION_OPTIONS_START ("En garde!")} +#define GOLD_QUESTIONS +{QUESTION_OPTION ("How much gold do my units cost?") ("You need to pay each unit you recruit or recall gold when you recruit it. The cost of recruiting a unit is displayed under the unit's name. The cost of recalling a unit is always 20 gold. A unit also costs gold for each turn it is under your control. This cost, called 'upkeep', is equal to the level of the unit. However, units you do not recruit or recall such as your leader do not cost any gold at all. The total upkeep cost of your units is displayed on the status bar at the top after a picture of gold and then a red arrow.")} +{QUESTION_OPTION ("How do I get gold?") ("You begin each level with a percentage of gold from the previous level. If this is less than 100 gold, you begin with 100 gold instead. The amount of gold you have is displayed on the status bar after the picture of gold. After the start of a scenario, you receive 2 gold every turn. Since you usually need more gold than that, you should flag villages, which give you 1 gold per turn.")} +#enddef + {GOLD_QUESTIONS} + {QUESTION_OPTIONS_END} + [/event] + [event] + name=turn 4 + [message] + description=Delfador + message= _ "The sun is setting over Wesnoth. The time of day affects how much damage units of different alignments can inflict upon each other." + [/message] + {QUESTION_OPTIONS_START ("En garde!")} +#define TIME_QUESTIONS +{QUESTION_OPTION ("What are the different alignments and times of day?") ("There are 3 alignments: Lawful, Neutral, and Chaotic. There are also 3 times of day: day, twilight, and night. During day, units of the alignment Lawful, such as humans, do 25% more damage, while Chaotic units such as undead do 25% less. At night it is reversed. During twilight, all units do their normal damage. Neutral units such as elves are unaffected by day and night.")} +{QUESTION_OPTION ("How do I know what time of day it is?") ("The times of day usually progress in a sequence: twilight, day, day, twilight, night, night, then repeat. However some scenarios have a different sequence, such as underground where it is perpetually night. You can find out the current time of day by looking at the Status Table.")} +#enddef + {TIME_QUESTIONS} + {QUESTION_OPTIONS_END} + [/event] + [event] + name=turn 5 + [message] + description=Delfador + message= _ "In Wesnoth, each hex has a terrain, which gives the hex distinctive properties." + [/message] + {QUESTION_OPTIONS_START ("En garde!")} +#define TERRAIN_QUESTIONS +{QUESTION_OPTION ("What are the different properties that terrains have?") ("Two terrains have properties which have already been described; namely villages and castle. However the properties of most terrains are more subtle, and have to do with the advantages and disadvantages different units have when they move onto them. The first property of a terrain is the number of move points it takes each unit to move through the hex. The second property is the defense that the terrain gives units standing on it.")} +{QUESTION_OPTION ("How do I find out the properties of a specific terrain?") ("To find out the properties of a terrain with respect to a specific unit, right-click on the unit, select Unit Description, then select Terrain Modifiers. To find out which terrain is on a particular hex, move your cursor over that hex and look in the upper-right hand corner of the screen. This will display, in order, the name of the terrain, then the coordinates of the hex, then the selected unit's defense, then the number of move points it will cost the selected unit to move through that hex.")} +#enddef + {TERRAIN_QUESTIONS} + {QUESTION_OPTIONS_END} + [/event] + [item] + x,y=12,9 + image=items/potion-red.png + [/item] + [event] + name=moveto + [filter] + x,y=12,9 + side=1 + [/filter] + [message] + description=Delfador + message= _ "Some objects change the statistics of the unit that triggered them. One of your units found a potion which will make him do more damage on his attack. To see his new combat statistics, look at the Status Table." + [/message] + [object] + [effect] + apply_to=attack + increase_damage=4 + [/effect] + description=This potion increases the damage of all the drinker's attacks by four. + name=Strength Potion + image=items/potion-red.png + [/object] + {QUESTION_OPTIONS_START ("En garde!")} +#define OBJECT_QUESTIONS +{QUESTION_OPTION ("What kind of objects am I likely to encounter?") ("The objects you encounter are put in by the scenario designer, so they vary from campaign to campaign. In Heir to the Throne, most objects give the unit who picks them up a new weapon. However one of the principles of Wesnoth is to avoid being a *get-the-powerups* game, so there are usually not that many objects in a campaign.")} +{QUESTION_OPTION ("How long do these objects last?") ("Most objects are permanent changes to the unit that receives them. However a few objects, such as holywater, last only until the remainder of the level.")} +#enddef + {OBJECT_QUESTIONS} + {QUESTION_OPTIONS_END} + [removeitem] + [/removeitem] + [/event] + [event] + name=die + [filter] + description=Konrad + [/filter] + [message] + description=Delfador + message= _ "Unfortunately, you lost, because your leader was defeated. Hopefully you have gained wisdom from my teachings anyway." + [/message] + [/event] + [event] + name=time over + [message] + description=Delfador + message= _ "Unfortunately, you lost, because you ran out of time. Hopefully you have gained wisdom from my teachings anyway." + [/message] + [/event] + [event] + name=die + [filter] + description=Delfador + [/filter] + [message] + description=Delfador + message= _ "Congratulations! You have defeated me, and completed the second and final training scenario. Next, you may want to begin a campaign, or play multiplayer." + [/message] + {QUESTION_OPTIONS_START ("Hooray!")} +#define WESNOTH_QUESTIONS +{QUESTION_OPTION ("How do I play a campaign?") ("To begin a campaign, run Wesnoth, select 'Campaign', select which campaign to play, then select Easy, Normal, or Hard. Heir to the Throne is the suggested for newcomers to Wesnoth.")} +{QUESTION_OPTION ("How do I play multiplayer?") ("To play Wesnoth against other people, select 'Multiplayer'. If you have the latest development version of Wesnoth, select 'Join Official Server'. However, if you have version 1.0, select 'Join Game', then type in 'server.wesnoth.org'. This will connect you to the official Wesnoth server, where you can join a game by selecting it, then selecting 'Join Game'.")} +#enddef + {WESNOTH_QUESTIONS} + {QUESTION_OPTIONS_END} + [message] + description=Delfador + message= _ "Do you want to review any of the skills learned on this level?" + [option] + message= _ "Yes" + [command] + {QUESTION_OPTIONS_START ("I'm done reviewing skills!")} + {TRAIT_QUESTIONS} + {GOLD_QUESTIONS} + {TIME_QUESTIONS} + {TERRAIN_QUESTIONS} + {OBJECT_QUESTIONS} + {WESNOTH_QUESTIONS} + {QUESTION_OPTIONS_END} + [/command] + [/option] + [option] + message= _ "No" + [/option] + [/message] + [endlevel] + result=victory + next_scenario=null + bonus=yes + [/endlevel] + [/event] +[/tutorial] diff --git a/data/scenarios/tutorial/utils.cfg b/data/scenarios/tutorial/utils.cfg new file mode 100644 index 00000000000..d272456414d --- /dev/null +++ b/data/scenarios/tutorial/utils.cfg @@ -0,0 +1,34 @@ +#define QUESTION_OPTIONS_START END_MESSAGE +{VARIABLE still_asking_questions yes} +[while] +[variable] +name=still_asking_questions +equals=yes +[/variable] +[do] + [message] + description=Konrad + message= _ "That was explained well! But.." + [option] + message= _ {END_MESSAGE} + [command] + {CLEAR_VARIABLE still_asking_questions} + [/command] + [/option] +#enddef +#define QUESTION_OPTION QUESTION ANSWER +[option] +message= _ {QUESTION} +[command] + [message] + description=Delfador + message= _ {ANSWER} + [/message] +[/command] +[/option] +#enddef +#define QUESTION_OPTIONS_END + [/message] +[/do] +[/while] +#enddef diff --git a/data/units/Great_Troll.cfg b/data/units/Great_Troll.cfg new file mode 100644 index 00000000000..575bffa4c43 --- /dev/null +++ b/data/units/Great_Troll.cfg @@ -0,0 +1,34 @@ +[unit] +name=Great Troll +race=troll +image=great-troll.png +#image_defensive=great-troll-defend.png +ability=regenerates +hitpoints=80 +movement_type=largefoot +movement=5 +experience=500 +level=3 +alignment=chaotic +advanceto=null +cost=38 +unit_description="Great Trolls are strong and brutal humanoid monsters with the amazing ability to regenerate themselves, so that they recover from wounds on their own, even during battle." +get_hit_sound=ugg.wav +usage=fighter + [attack] + name=mace + type=impact + range=short + damage=18 + number=3 + [frame] + begin=-100 + end=100 + image=great-troll-attack.png + [/frame] + [sound] + time=-100 + sound=staff.wav + [/sound] + [/attack] +[/unit] diff --git a/data/units/Orcish_Leader.cfg b/data/units/Orcish_Leader.cfg new file mode 100644 index 00000000000..1e930003398 --- /dev/null +++ b/data/units/Orcish_Leader.cfg @@ -0,0 +1,59 @@ +[unit] +name=Orcish Leader +race=orc +image=orcish-leader.png +image_defensive=orcish-leader-defend.png +#profile=misc/kapoue.png +hitpoints=45 +ability=leadership +movement_type=orcishfoot +movement=6 +experience=60 +level=1 +alignment=chaotic +advanceto=Orcish Ruler +cost=120 +usage=mixed fighter +unit_description="Orcish Rulers are the chiefs of their tribe. They make the important decisions and lead their people into battle. They carry a bow out of necessity, but are much more skilled with the sword; all in all, they are powerful fighters. Their natural leadership skills make them very precious in the battle: if the Ruler is lost, so is the battle." +get_hit_sound=orc-hit.wav + [attack] + name=sword + type=blade + range=short + damage=7 + number=3 + [frame] + begin=-100 + end=100 + image=orcish-leader-attack.png + [/frame] + [sound] + time=-250 + sound=sword-swish.wav + [/sound] + [/attack] + [attack] + name=bow + type=pierce + range=long + damage=5 + number=2 + [sound] + time=-100 + sound=firearrow.wav + [/sound] + + [sound] + time=0 + sound=arrow-hit.wav + sound_miss=arrow-miss.wav + [/sound] + + [missile_frame] + begin=-100 + end=0 + image=projectiles/missile-n.png + image_diagonal=projectiles/missile-ne.png + [/missile_frame] + [/attack] +[/unit] diff --git a/data/units/Orcish_Sovereign.cfg b/data/units/Orcish_Sovereign.cfg new file mode 100644 index 00000000000..c758e724dd3 --- /dev/null +++ b/data/units/Orcish_Sovereign.cfg @@ -0,0 +1,53 @@ +[unit] +name=Orcish Sovereign +race=orc +image=orcish-ruler.png +#profile=misc/kapoue.png +hitpoints=75 +ability=leadership +movement_type=orcishfoot +movement=6 +experience=500 +level=3 +alignment=chaotic +advanceto=null +cost=120 +usage=mixed fighter +unit_description="Orcish Sovereign are the chiefs of their tribe. They make the important decisions and lead their people into battle. They carry a bow out of necessity, but are much more skilled with the sword; all in all, they are powerful fighters. Their natural leadership skills make them very precious in the battle: if the Ruler is lost, so is the battle." +get_hit_sound=orc-hit.wav + [attack] + name=sword + type=blade + range=short + damage=10 + number=4 + [sound] + time=-250 + sound=sword-swish.wav + [/sound] + [/attack] + [attack] + name=bow + type=pierce + range=long + damage=9 + number=3 + [sound] + time=-100 + sound=firearrow.wav + [/sound] + + [sound] + time=0 + sound=arrow-hit.wav + sound_miss=arrow-miss.wav + [/sound] + + [missile_frame] + begin=-100 + end=0 + image=projectiles/missile-n.png + image_diagonal=projectiles/missile-ne.png + [/missile_frame] + [/attack] +[/unit] diff --git a/data/units/Troll_Hero.cfg b/data/units/Troll_Hero.cfg new file mode 100644 index 00000000000..143744ec151 --- /dev/null +++ b/data/units/Troll_Hero.cfg @@ -0,0 +1,34 @@ +[unit] +name=Troll Hero +race=troll +image=troll-hero.png +#image_defensive=troll-hero-defend.png +ability=regenerates +hitpoints=60 +movement_type=largefoot +movement=5 +experience=52 +level=2 +alignment=chaotic +advanceto=Great Troll +cost=30 +unit_description="Trolls hero are strong and brutal humanoid monsters with the amazing ability to regenerate themselves, so that they recover from wounds on their own, even during battle." +get_hit_sound=ugg.wav +usage=fighter + [attack] + name=club + type=impact + range=short + damage=12 + number=3 + [frame] + begin=-100 + end=100 + image=troll-hero-attack.png + [/frame] + [sound] + time=-100 + sound=staff.wav + [/sound] + [/attack] +[/unit] diff --git a/images/great-troll-attack.png b/images/great-troll-attack.png new file mode 100644 index 00000000000..bcfdc0b790d Binary files /dev/null and b/images/great-troll-attack.png differ diff --git a/images/great-troll-defend.png b/images/great-troll-defend.png new file mode 100644 index 00000000000..c8978841c9a Binary files /dev/null and b/images/great-troll-defend.png differ diff --git a/images/great-troll.png b/images/great-troll.png new file mode 100644 index 00000000000..3ac4fc8a4a1 Binary files /dev/null and b/images/great-troll.png differ diff --git a/images/neutral-outlaw+female-attack.png b/images/neutral-outlaw+female-attack.png new file mode 100644 index 00000000000..b53860601a2 Binary files /dev/null and b/images/neutral-outlaw+female-attack.png differ diff --git a/images/neutral-outlaw+female-attack1.png b/images/neutral-outlaw+female-attack1.png new file mode 100644 index 00000000000..2c749f0a968 Binary files /dev/null and b/images/neutral-outlaw+female-attack1.png differ diff --git a/images/neutral-outlaw+female-attack2.png b/images/neutral-outlaw+female-attack2.png new file mode 100644 index 00000000000..9484c9afc6a Binary files /dev/null and b/images/neutral-outlaw+female-attack2.png differ diff --git a/images/neutral-outlaw+female-defend.png b/images/neutral-outlaw+female-defend.png new file mode 100644 index 00000000000..9eaf64b25b1 Binary files /dev/null and b/images/neutral-outlaw+female-defend.png differ diff --git a/images/neutral-outlaw+female.png b/images/neutral-outlaw+female.png new file mode 100644 index 00000000000..c9fddd8dffd Binary files /dev/null and b/images/neutral-outlaw+female.png differ diff --git a/images/orcish-leader-attack.png b/images/orcish-leader-attack.png new file mode 100644 index 00000000000..3e14d38bdae Binary files /dev/null and b/images/orcish-leader-attack.png differ diff --git a/images/orcish-leader-defend.png b/images/orcish-leader-defend.png new file mode 100644 index 00000000000..50a00b51acc Binary files /dev/null and b/images/orcish-leader-defend.png differ diff --git a/images/orcish-leader.png b/images/orcish-leader.png new file mode 100644 index 00000000000..897dd5ac0a9 Binary files /dev/null and b/images/orcish-leader.png differ diff --git a/images/orcish-ruler-attack.png b/images/orcish-ruler-attack.png new file mode 100644 index 00000000000..79d747257c0 Binary files /dev/null and b/images/orcish-ruler-attack.png differ diff --git a/images/orcish-ruler-defend.png b/images/orcish-ruler-defend.png new file mode 100644 index 00000000000..b6f4f17f95c Binary files /dev/null and b/images/orcish-ruler-defend.png differ